catty-hatty

О журнале.

"...Пусть тот, кто ищет, не перестает искать до тех пор, пока не найдет, и, когда он найдет, он будет потрясен, и, если он потрясен, он будет удивлен, и он будет царствовать над всем."

Блог создан для общения на профессиональные темы. Просветительская работа не предполагается, но на вопросы отвечаю, спрашивать здесь. Несколько ссылок по специальности:

РосОнкоВеб                 Онкология.ру                Научный атеизм                       RichardDawkins.ru (много ссылок)

Практическая молекулярная биология        Наука и технологии России       Мой геном (научно-популярный сайт)

cheshir

Коронавирус и ВИЧ: потроллим Люка Монтанье

# Length: 101
# Identity:      60/101 (59.4%)
# Similarity:    60/101 (59.4%)
# Gaps:           4/101 ( 4.0%)
# Score: 112
# =======================================
SARS-Cov-2     4857 GTGATAAAAGTGTATATTACACTAGTAATCCTACCACAT---TCCACCTA   4903
                   ||.|||||..|.|..|..|.|.|.|.||||..||.||.|   |..|....
HIV-1          7614 GTAATAAATCTCTGGAACAGATTTGGAATCACACGACCTGGATGGAGTGG   7663

SARS-Cov-2     4904 GATGGTGAAGTTATCACCTTTGACAATCTTAAGACACTTCTTTCTTTGAGA   4954
                   ||..|.|||.|||.||. ||..||||.|||||.|||||.|||..||..|||
HIV-1          7664 GACAGAGAAATTAACAA-TTACACAAGCTTAATACACTCCTTAATTGAAGA   7713
#---------------------------------------

Score Expect Identities Gaps Strand
37.4 bits(40) 5.2 26/30(87%) 0/30(0%) Plus/Minus
HIV-1 2542 TCCACAGGGATGGAAAGGATCACCAGCAAT  2571
          ||| | ||||| | ||||||||||||||||
MERS  141  TCCGCGGGGATCGTAAGGATCACCAGCAAT  112


Можно смеяться. Ха-ха.

#SARS-Cov-2, #HIV-1; #coronavirus; #MERS; #AIDS; #коронавирус; #СПИД
catty-hatty

2019-nCoV мог возникнуть в результате рекомбинации вирусов

Ещё одна проблема, которая привлекла значительное внимание, состоит в том, является ли SARS-CoV-2 рекомбинантным вирусом, и могла ли такая рекомбинация способствовать его появлению. Осложняющий фактор состоит в том, что среди сарбековирусов и коронавирусов вообще рекомбинация широко распространена, поэтому выделить конкретную рекомбинацию, которая привела к появлению SARS-CoV-2 на общем высоком рекомбинационном фоне – непростая задача. В геноме сарбековирусов, включая S белок, а также близкородственных SARS-CoV-2 вирусов летучих мышей, заметны множество точек рекомбинации. Например, есть признаки рекомбинации между SARS-CoV-2, RaTG13 и коронавирусами панголина из Гуандоня (Lam et al., 2020). Кроме того, геном RmYN02 также в высокой степени подвержен рекомбинации (Zhou et al., 2020).

“Another issue that has received considerable attention is whether SARS-CoV-2 is a recombinant virus, and whether such recombination might have facilitated its emergence (Lu et al., 2020; Wu et al., 2020). The complicating factor here is that sarbeviruses, and coronaviruses more broadly, experience widespread recombination, so that distinguishing recombination that assisted virus emergence from ‘‘background’’ recombination events is not trivial. Recombination is visible at multiple locations across the sarbevirus genome, including in the S protein, and in bat viruses closely related to SARS-CoV-2. For example, there is some evidence for recombination among SARS-CoV-2, RaTG13, and the Guangdong pangolin CoVs (Lam et al., 2020), and the genome of RmYN02 has similarly been widely impacted by recombination (Zhou et al., 2020). “

Zhang et al., 2020. A Genomic Perspective on the Origin and Emergence of SARS-CoV-2. https://doi.org/10.1016/j.cell.2020.03.035

A novel bat coronavirus reveals natural insertions at the S1/S2 cleavage siteof the Spike protein and a possible recombinant origin of HCoV-19

Zhou et al., 2020. https://doi.org/10.1101/2020.03.02.974139

“Together, these data suggest that HCoV HCoV-19 originated from 42 multiple naturally occurring recombination events among those viruses present in bats and 43 other wildlife species.”

catty-hatty

2019-nCoV (SARS-CoV-2) – биологическое оружие?

Проф. Ф. Бойл, США, цитируя 4 научные статьи, аргументирует происхождение коронавируса 2019 из лабораторий по созданию/изучению биологического оружия из США, Китая и Австралии

Экс­перт по био­ло­ги­че­ско­му оружию, про­фес­сор права Фр­эн­сис Бойл, уни­вер­си­тет Ил­ли­ной­са, США, в ин­тер­вью Алексу Джонсу по­де­лил­ся своими на­ход­ка­ми - на­уч­ны­ми ста­тья­ми - ко­то­рые с убе­ди­тель­но­стью улик "ды­мя­ще­го­ся ружья" сви­де­тель­ству­ют о том, что ко­ро­на­ви­рус 2019-nCov был раз­ра­бо­тан как био­ло­ги­че­ское оружие, скон­стру­и­ро­ван для "эф­фек­тив­но­го рас­про­стра­не­ния в че­ло­ве­че­ской по­пу­ля­ции", ци­ти­руя одну из при­ве­ден­ных им на­уч­ных статей.

Ресурс Natural News при­во­дит полный тран­скрипт дан­но­го ин­тер­вью. Ниже дан пе­ре­вод наи­бо­лее важных вы­ска­зы­ва­ний Ф. Бойла (опус­кая почти пол­но­стью треп Алекса Джонса, ко­то­рый с оче­вид­но­стью пы­та­ет­ся под­толк­нуть со­бе­сед­ни­ка к пре­уве­ли­чен­ным без­до­ка­за­тель­ным утвер­жде­ни­ям).

Читать полностью

[science paper 1]: Antiviral Research, Volume 176, April 2020, online since Feb 10 2020: The spike glycoprotein of the new coronavirus 2019-nCoV contains a furin-like cleavage site absent in CoV of the same clade. На 25-02-2020 описание статьи было удалено с сайта science direct. Доступ к препринту статьи через sci-hub. Detailed comments on the paper by Mike Adams: as the science authors of the paper explain in the full text, “This furin-like cleavage site… may provide a gain-of-function to the 2019-nCoV for efficient spreading in the human population.”

[science paper 2]: Nature Medicine, 2015-11-09: A SARS-like cluster of circulating bat coronaviruses shows potential for human emergence.

[science paper 3]: Archives of Virology 2010, 155. Angiotensin-converting enzyme 2 (ACE2) proteins of different batspecies confer variable susceptibility to SARS-CoV entry.

[science paper 4]: ResearchGate preprint, The possible origins of 2019-nCoV coronavirus. [на 25 февраля статья удалена с researchgate. поэтому приведена ссылка на сохраненную копию]

catty-hatty

SARS-like cluster of circulating bat coronavirus pose threat for human emergence

SARS-like cluster of circulating bat coronavirus pose threat for human emergence

Vineet D. Menachery1, Boyd L. Yount Jr1, Kari Debbink1,2, Sudhakar Agnihothram3, Lisa E. Gralinski1, Jessica A. Plante1, Rachel L. Graham1, Trevor Scobey1, Xing-Yi Ge8, Eric F. Donaldson1, Scott H. Randell4,5, Antonio Lanzavecchia6, Wayne A. Marasco7, Zhengli-Li Shi8, and Ralph S. Baric1,2 1Departments of Epidemiology, University of North Carolina at Chapel Hill, Chapel Hill, NC, USA 2Microbiology and Immunology, University of North Carolina at Chapel Hill, Chapel Hill, NC, USA 3National Center for Toxicological Research, Food and Drug Administration, Jefferson, AR, USA 4Department of Cell Biology and Physiology, University of North Carolina at Chapel Hill, Chapel Hill, NC, USA 5Marsico Lung Institute/Cystic Fibrosis Center, University of North Carolina at Chapel Hill, Chapel Hill, NC, USA 6 Institute for Research in Biomedicine, Bellinzona, Switzerland Institute of Microbiology, ETH Zurich, Zurich, Switzerland 7Department of Cancer Immunology and AIDS, Dana-Farber Cancer Institute; Department of Medicine, Harvard Medical School, Boston Massachusetts, USA 8Key Laboratory of Special Pathogens and Biosafety, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China Abstract The emergence of Severe Acute Respiratory Syndrome

Coronavirus (SARS-CoV) and Middle East Respiratory Syndrome (MERS)-CoV underscores the threat of cross-species transmission events leading to outbreaks in humans. In this study, we examine the disease potential for SARSlike CoVs currently circulating in Chinese horseshoe bat populations. Utilizing the SARS-CoV infectious clone, we generated and characterized a chimeric virus expressing the spike of bat coronavirus SHC014 in a mouse adapted SARS-CoV backbone. The results indicate that group 2b viruses encoding the SHC014 spike in a wild type backbone can efficiently utilize multiple ACE2 receptor orthologs, replicate efficiently in primary human airway cells, and achieve in vitro titers equivalent to epidemic strains of SARS-CoV. Additionally, in vivo experiments demonstrate replication of the chimeric virus in mouse lung with notable pathogenesis. Evaluation of available SARS-based immune-therapeutic and prophylactic modalities revealed poor efficacy; both monoclonal antibody and vaccine approaches failed to neutralize and protect from CoVs utilizing the novel spike protein. Importantly, based on these findings, we synthetically rederived an infectious full length SHC014 recombinant virus and demonstrate robust viral replication both in vitro and in vivo. Together, the work highlights a continued risk of SARS-CoV reemergence from viruses currently circulating in bat populations.

https://www.med.unc.edu/orfeome/files/2018/03/a-sars-like-cluster-of-circulating-bat-coronaviruses-shows-potential-for-human-emergence.pdf?fbclid=IwAR3c_PY5RbTdLHuYxRZUcTPQHdQjFzy8JN6TUsygDRq0DkDEH_GrPKzuX-c

Профессор Ральф Барик - глава кафедры эпидемиологии Университета Северной Каролины в Чапел-Хилл, с соавт. создатель коронавируса SARS-cov2.

Вот их статья 2015 года: https://www.med.unc.edu/…/a-sars-like-cluster-of-circulatin…

Они вывели очень похожий на Covid19 вирус чтоб доказать, что вирусы летучих мышей могут быть очень опасны.

В статье они взяли за основу вирус атипичной пневмонии и "надели" на него шипы от вируса летучих мышей из Уханя (там китаец Ченгли Ли Ши соавтор, он и передал материал...). Затем пассировали полученную химеру на клетках верхних дыхательн путей человека, чтоб он лучше приспособился.

Получился патогенный вирус с высокой инфекционностью для человека и устойчивый к известным препаратам и сывороткам.

Кто знает, сколько подобных вирусов они сконструировали, но не опубликовали.
***

Итого, текущий вирус действительно очень опасен и противоэпидемические мероприятия оправданы.

ЗЫ: при репосте копируйте текст, иначе публикуется только статья на английском.

Отсюда

catty-hatty

Клинические симптомы инфекции коронавирусом 2019-nCov

Clinical Characteristics of 138 Hospitalized Patients With 2019 Novel Coronavirus–Infected Pneumonia inWuhan, China

DaweiWang, MD; Bo Hu, MD; Chang Hu, MD; Fangfang Zhu, MD; Xing Liu, MD; Jing Zhang, MD; BinbinWang, MD; Hui Xiang, MD;
Zhenshun Cheng, MD; Yong Xiong, MD; Yan Zhao, MD; Yirong Li, MD; XinghuanWang, MD; Zhiyong Peng, MD

IMPORTANCE In December 2019, novel coronavirus (2019-nCoV)–infected pneumonia (NCIP)
occurred inWuhan, China. The number of cases has increased rapidly but information on the
clinical characteristics of affected patients is limited.

OBJECTIVE To describe the epidemiological and clinical characteristics of NCIP.

DESIGN, SETTING, AND PARTICIPANTS Retrospective, single-center case series of the 138
consecutive hospitalized patients with confirmed NCIP at Zhongnan Hospital ofWuhan
University inWuhan, China, from January 1 to January 28, 2020; final date of follow-up was
February 3, 2020.

EXPOSURES Documented NCIP.

MAIN OUTCOMES AND MEASURES Epidemiological, demographic, clinical, laboratory,
radiological, and treatment data were collected and analyzed. Outcomes of critically ill
patients and noncritically ill patients were compared. Presumed hospital-related transmission
was suspected if a cluster of health professionals or hospitalized patients in the same wards
became infected and a possible source of infection could be tracked.

RESULTS Of 138 hospitalized patients with NCIP, the median age was 56 years (interquartile
range, 42-68; range, 22-92 years) and 75 (54.3%) were men. Hospital-associated
transmission was suspected as the presumed mechanism of infection for affected health
professionals (40 [29%]) and hospitalized patients (17 [12.3%]). Common symptoms
included fever (136 [98.6%]), fatigue (96 [69.6%]), and dry cough (82 [59.4%]).

Lymphopenia (lymphocyte count, 0.8 × 109/L [interquartile range {IQR}, 0.6-1.1]) occurred in
97 patients (70.3%), prolonged prothrombin time (13.0 seconds [IQR, 12.3-13.7]) in 80
patients (58%), and elevated lactate dehydrogenase (261 U/L [IQR, 182-403]) in 55 patients
(39.9%).
Chest computed tomographic scans showed bilateral patchy shadows or
ground glass opacity in the lungs of all patients. Most patients received antiviral therapy
(oseltamivir, 124 [89.9%]), and many received antibacterial therapy (moxifloxacin, 89
[64.4%]; ceftriaxone, 34 [24.6%]; azithromycin, 25 [18.1%]) and glucocorticoid therapy
(62 [44.9%]). Thirty-six patients (26.1%) were transferred to the intensive care unit (ICU)
because of complications, including acute respiratory distress syndrome (22 [61.1%]),
arrhythmia (16 [44.4%]), and shock (11 [30.6%]). The median time from first symptom to
dyspnea was 5.0 days, to hospital admission was 7.0 days, and to ARDS was 8.0 days.
Patients treated in the ICU (n = 36), compared with patients not treated in the ICU (n = 102),
were older (median age, 66 years vs 51 years), were more likely to have underlying
comorbidities (26 [72.2%] vs 38 [37.3%]), and were more likely to have dyspnea (23 [63.9%]
vs 20 [19.6%]), and anorexia (24 [66.7%] vs 31 [30.4%]). Of the 36 cases in the ICU, 4 (11.1%)
received high-flow oxygen therapy, 15 (41.7%) received noninvasive ventilation, and 17
(47.2%) received invasive ventilation (4 were switched to extracorporeal membrane
oxygenation). As of February 3, 47 patients (34.1%) were discharged and 6 died (overall
mortality, 4.3%), but the remaining patients are still hospitalized. Among those discharged
alive (n = 47), the median hospital stay was 10 days (IQR, 7.0-14.0).

CONCLUSIONS AND RELEVANCE In this single-center case series of 138 hospitalized patients
with confirmed NCIP inWuhan, China, presumed hospital-related transmission of 2019-nCoV
was suspected in 41%of patients, 26%of patients received ICU care, and mortality was 4.3%.
JAMA. doi:10.1001/jama.2020.1585
Published online February 7, 2020. Corrected on February 20, 2020.

catty-hatty

К вопросу о происхождении коронавируса 2019-nCoV

1. Современные технологии позволяют создавать биологическое оружие на основе вирусов. Для этого могут использоваться природные, модифицированные, а также химерные вирусы, полученные из нескольких вирусов с отбором на заданные свойства. Работы по искусственным коронавирусам ведутся давно и достаточно активно. Как правило, все открытые источники относятся к разработке вакцин. Поиск в базе научных работ PubMed по ключевым словам “recombinant coronavirus” выдал более 1500 статей. База патентов США USPTO содержит 5 патентов со словами “recombinant coronavirus” в заголовке патента и 4151 патент с упоминанием этих терминов в тексте.

2. Современные технологии также позволяют маскировать искусственное происхождение вирусов под естественное происхождение.

3. Случаи межвидовой передачи вирусов в природе, в том числе, от животных к человеку, известны. При этом вирусы в ходе изменчивости и отбора могут как специализироваться к новому виду хозяев, так и расширять перекрестную видоспецифичность.

4. На сегодняшний день открытые источники информации отрицают искусственное происхождение коронавируса #2019-nCoV (#COVID-19). Пока не  получено доказательств обратного, происхождение нового коронавируса будет считаться естественным.

5. Ранее сообщалось, что 2019-nCoV мог произойти при гомологичной рекомбинации между коронавирусом летучих мышей и другим неизвестным коронавирусом, из-за чего спайк-гликопротеин нового коронавируса приобрел сродство к поверхностному рецептору клеток человека. По первичной последовательности генома 2019-nCoV близок к коронавирусу летучих мышей, а по частоте использования кодонов напоминает #коронавирусы змей. По последним данным китайских исследователей, геном 2019-nCov на 99% совпадает с геномом коронавируса панголина, который, вероятно, является промежуточным хозяином нового коронавируса.

catty-hatty

2019-nCOV: один азиат и глобальные выводы

Single-cell RNA expression profiling of ACE2, the putative receptor of Wuhan 2019-nCov

Yu Zhao, Zixian Zhao, Yujia Wang, Yueqing Zhou, Yu Ma, Wei Zuo

doi: https://doi.org/10.1101/2020.01.26.919985

A novel coronavirus (2019-nCov) was identified in Wuhan, Hubei Province, China in December of 2019. This new coronavirus has resulted in thousands of cases of lethal disease in China, with additional patients being identified in a rapidly growing number internationally. 2019-nCov was reported to share the same receptor, Angiotensin-converting enzyme 2 (ACE2), with SARS-Cov. Here based on the public database and the state-of-the-art single-cell RNA-Seq technique, we analyzed the ACE2 RNA expression profile in the normal human lungs. The result indicates that the ACE2 virus receptor expression is concentrated in a small population of type II alveolar cells (AT2). Surprisingly, we found that this population of ACE2-expressing AT2 also highly expressed many other genes that positively regulating viral reproduction and transmission. A comparison between eight individual samples demonstrated that the Asian male one has an extremely large number of ACE2-expressing cells in the lung. This study provides a biological background for the epidemic investigation of the 2019-nCov infection disease, and could be informative for future anti-ACE2 therapeutic strategy development.

The copyright holder for this preprint (which was not peer-reviewed) is the author/funder, who has granted bioRxiv a license to display the preprint in bioRxiv preprint first posted online Jan. 26, 2020; doi: http://dx.doi.org/10.1101/2020.01.26.919985"

catty-hatty

О журналах хороших и, мягко говоря, разных

5th May, 2018

Jacob Schaf, Universidade Federal do Rio Grande do Sul

The aim of this comment is not giving support to fake journals, however to show that the actual proliferation of alternative journals is a natural response to the current erroneous scientific policy of the mainstream journals.

The mainstream journals have the financial support of powerful institutions. Moreover, on selling their journals to a vast community of customers, they ever had copious financial income, so that they could exempt authors from publication fees. However, if the young scientists can publish for free, why do they accept to pay heavy publication fees? Actually, so many alternative journals proliferate, because of the deleterious ideology adopted by the establishment.

Scientists produce knowledge not for money, however pursue their natural impulse to understand the laws governing nature. This is an innate vocation and a most profound aspiration of humans. Journals are only interested in money. Obviously, knowledge becomes useful and gets value only if it is shared and discussed with the scientific community. Ideologies and dogmas are used in religions and or profited by politicians to get people under control. Ideologies all are deleterious to scientific progress, because they decide wisdom by authority. Scientific knowledge is not created, however discovered by open minded people. There is no place for authority. In conclusion, the current wrong scientific policy is the drive behind the proliferation of scientific publishers, interested in money. The goal of the true scientists is knowledge and if they are forced to pay for it, they pay.

It is disappointing that we have not learned the lesson from the many horrible anti-scientific happenings in the middle age, and now forced to revive the same stupidities in a century where we humans are beginning to understand the whole universe.

https://www.researchgate.net/post/Is_Scientific_Research_Publishing_a_good_not_fake_publisher

catty-hatty

Бюллетень "В защиту науки" №22

Оглавление
1. Е.Б. Александров
Судный год (предисловие редактора) ............................3
2. О концепции «релиз-активности» (заявление
Комиссии РАН по борьбе с лженаукой)......................10
3. В.Е.Захаров
Главное – репутация Академии наук...........................12
4. Н.Н.Хромов-Борисов
О «релиз-активности» популярно. Легко ли понять,
что она не существует?..................................................21
5. Н.Н.Хромов-Борисов
Анаферон, дети, клещевой энцефалит ........................34
6. Steven Novella
Релиз-активные препараты – гомеопатия
под другим названием...................................................41
7. А.Ю.Панчин
Наша маленькая победа................................................44
8. Г.А.Мельниченко
Письмо в Комиссию.....................................................49
9. М.С.Гельфанд
Без показаний к применению ......................................50
10. Письмо А.В. Абрамову..................................................61
11. Е.Б. Александров
Предыстория Комиссии РАН по борьбе
с лженаукой...................................................................64
123
12. Б.Е.Рябчиков
Комментарий к отзыву профессора В.И. Высоцкого
и его неназванного соавтора на статью
«Экспериментальная проверка возможности
трансмутации радионуклида 137Cs в биологических
системах.........................................................................79
13. Биологическая и химическая трансмутация
радиоактивных изотопов ..............................................83
14. П.М.Толстой, Е.Ю. Тупикина
Лечебные свойства лёгкой воды...................................99
15. В.А.Кувакин
Лженаука и внутренний аудит.................................... 108
16. Из нашей почты.......................................................... 117
Сведения об авторах........................................................... 121

Скачать